Review



mouse atf4 sirna  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Santa Cruz Biotechnology mouse atf4 sirna
    Figure 4. mTORC1 activation is an upstream event in palmitate induced <t>ATF4</t> activation. A: AML12 cells were pretreated with or without Torin1 (0.25 mM) or rapamycin (Rapa at 50 nM) for 2 h before palmitate (0.4 mM) exposure for 16 h. Total protein was extracted. Protein abundance of ATF4 and actin were detected by Western blotting. The signal of ATF4 protein band was measured by densitometry and then divided by the sig- nal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 3 separate experiments. Student’s t test was used for statistical evaluation (P < 0.001 vs. control). B: AML12 were pretreated with Torin1 (0.25 mM) for 2 h before a 16-h palmitate (0.4 mM) exposure. Total RNA was extracted. ATF4 mRNA levels were detected by real time-qPCR. Data are expressed as means ± SD, n = 4 sep- arated experiments. Differences between the two groups were deter- mined using Student’s t test (P < 0.001 vs. control). ATF, activating transcription factor.
    Mouse Atf4 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 73 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+atf4+sirna/ATF-4+siRNA/pm34378991-58-22-25
    Average 93 stars, based on 73 article reviews
    mouse atf4 sirna - by Bioz Stars, 2026-09
    93/100 stars

    Images

    1) Product Images from "Nicotinamide N-methyltransferase upregulation via the mTORC1-ATF4 pathway activation contributes to palmitate-induced lipotoxicity in hepatocytes."

    Article Title: Nicotinamide N-methyltransferase upregulation via the mTORC1-ATF4 pathway activation contributes to palmitate-induced lipotoxicity in hepatocytes.

    Journal: American journal of physiology. Cell physiology

    doi: 10.1152/ajpcell.00195.2021

    Figure 4. mTORC1 activation is an upstream event in palmitate induced ATF4 activation. A: AML12 cells were pretreated with or without Torin1 (0.25 mM) or rapamycin (Rapa at 50 nM) for 2 h before palmitate (0.4 mM) exposure for 16 h. Total protein was extracted. Protein abundance of ATF4 and actin were detected by Western blotting. The signal of ATF4 protein band was measured by densitometry and then divided by the sig- nal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 3 separate experiments. Student’s t test was used for statistical evaluation (P < 0.001 vs. control). B: AML12 were pretreated with Torin1 (0.25 mM) for 2 h before a 16-h palmitate (0.4 mM) exposure. Total RNA was extracted. ATF4 mRNA levels were detected by real time-qPCR. Data are expressed as means ± SD, n = 4 sep- arated experiments. Differences between the two groups were deter- mined using Student’s t test (P < 0.001 vs. control). ATF, activating transcription factor.
    Figure Legend Snippet: Figure 4. mTORC1 activation is an upstream event in palmitate induced ATF4 activation. A: AML12 cells were pretreated with or without Torin1 (0.25 mM) or rapamycin (Rapa at 50 nM) for 2 h before palmitate (0.4 mM) exposure for 16 h. Total protein was extracted. Protein abundance of ATF4 and actin were detected by Western blotting. The signal of ATF4 protein band was measured by densitometry and then divided by the sig- nal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 3 separate experiments. Student’s t test was used for statistical evaluation (P < 0.001 vs. control). B: AML12 were pretreated with Torin1 (0.25 mM) for 2 h before a 16-h palmitate (0.4 mM) exposure. Total RNA was extracted. ATF4 mRNA levels were detected by real time-qPCR. Data are expressed as means ± SD, n = 4 sep- arated experiments. Differences between the two groups were deter- mined using Student’s t test (P < 0.001 vs. control). ATF, activating transcription factor.

    Techniques Used: Activation Assay, Quantitative Proteomics, Western Blot, Control

    Figure 5. mTORC1 activation contributes to palmi- tate-induced ER stress and NNMT upregulation. A and B: AML12 cells were pretreated with Torin1 (0.25 mM) for 2 h before the palmitate (0.4 mM) exposure for 16 h. Total RNA was extracted. The gene expres- sions of Xbp1, Xbp1s, and Xbp1u were quantified by real time-qPCR and Xbp1s/Xbp1u ratio calculated. Data are expressed as means ± SD, n = 4 different experiments. Differences between the two groups were determined using Student’s t test (P < 0.001vs. control). C: AML12 cells were pretreated with Tornin1 for 2 h before tunicamycin (10 μm) treat- ment for 16 h. Protein abundance of p-S6 and actin was detected by Western blotting. The signal of p-S6 protein band was measured by densitometry and then divided by the signal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 5 separate experiments. Student’s t test was used for statistical evaluation (P < 0.01; P < 0.0001 vs. control). D: Ten- week-old male C57BL/6N mice were injected with tunicamycin (2 mg/kg body wt ip) or isovolumic vehi- cle (150 mM dextrose) and 16 h later livers were har- vested. Protein abundance of ATF4, p-S6 and actin was detected by Western blotting. E: AML12 cells were pretreated with Torin1 (0.25 mM) for 2 h before tunicamycin (10 μm) treatment for 16 h. Protein abun- dance of ATF4 was detected by Western blotting. F: AML12 cells were pretreated with Torin1 for 2 h before tunicamycin (10 μm) treatment for 16 h. Total RNA was extracted and NNMT gene expression quantified by real time-qPCR. All data were expressed as means ± SD, n = 4 separated experiments. Differences between the two groups were determined using Student’s t test (P < 0.01; P < 0.001; P < 0.0001 vs. control). NNMT, nicotinamide N-methyl- transferase; XBP1, X-box binding protein 1.
    Figure Legend Snippet: Figure 5. mTORC1 activation contributes to palmi- tate-induced ER stress and NNMT upregulation. A and B: AML12 cells were pretreated with Torin1 (0.25 mM) for 2 h before the palmitate (0.4 mM) exposure for 16 h. Total RNA was extracted. The gene expres- sions of Xbp1, Xbp1s, and Xbp1u were quantified by real time-qPCR and Xbp1s/Xbp1u ratio calculated. Data are expressed as means ± SD, n = 4 different experiments. Differences between the two groups were determined using Student’s t test (P < 0.001vs. control). C: AML12 cells were pretreated with Tornin1 for 2 h before tunicamycin (10 μm) treat- ment for 16 h. Protein abundance of p-S6 and actin was detected by Western blotting. The signal of p-S6 protein band was measured by densitometry and then divided by the signal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 5 separate experiments. Student’s t test was used for statistical evaluation (P < 0.01; P < 0.0001 vs. control). D: Ten- week-old male C57BL/6N mice were injected with tunicamycin (2 mg/kg body wt ip) or isovolumic vehi- cle (150 mM dextrose) and 16 h later livers were har- vested. Protein abundance of ATF4, p-S6 and actin was detected by Western blotting. E: AML12 cells were pretreated with Torin1 (0.25 mM) for 2 h before tunicamycin (10 μm) treatment for 16 h. Protein abun- dance of ATF4 was detected by Western blotting. F: AML12 cells were pretreated with Torin1 for 2 h before tunicamycin (10 μm) treatment for 16 h. Total RNA was extracted and NNMT gene expression quantified by real time-qPCR. All data were expressed as means ± SD, n = 4 separated experiments. Differences between the two groups were determined using Student’s t test (P < 0.01; P < 0.001; P < 0.0001 vs. control). NNMT, nicotinamide N-methyl- transferase; XBP1, X-box binding protein 1.

    Techniques Used: Activation Assay, Control, Quantitative Proteomics, Western Blot, Injection, Gene Expression, Binding Assay

    Figure 6. NNMT inhibition protects against palmitate-induced cell death. A: AML12 cells were pretreated with either JBSNF-000088 (20 mM) or II399 (20 mM) at the indicated concentrations for 4 h before palmitate (0.4 mM) exposure for 16 h. Cell viability was determined by LDH release mea- surement. Data are expressed as mean ± SD, n = 3 separated experi- ments. Bars with different character differ significantly (P < 0.05). B: AML12 cells were transfected with either scramble siRNA or NNMT siRNA for 24 h and treated with palmitate at 0.4 mM for 16 h. Cell death was determined by LDH release measurement. Data are expressed as means ± SD, n = 3 separated experiments. Differences between the two groups were determined using Student’s t test (P < 0.01; P < 0.001; P < 0.001 vs. control). NNMT, nicotinamide N-methyltransferase.
    Figure Legend Snippet: Figure 6. NNMT inhibition protects against palmitate-induced cell death. A: AML12 cells were pretreated with either JBSNF-000088 (20 mM) or II399 (20 mM) at the indicated concentrations for 4 h before palmitate (0.4 mM) exposure for 16 h. Cell viability was determined by LDH release mea- surement. Data are expressed as mean ± SD, n = 3 separated experi- ments. Bars with different character differ significantly (P < 0.05). B: AML12 cells were transfected with either scramble siRNA or NNMT siRNA for 24 h and treated with palmitate at 0.4 mM for 16 h. Cell death was determined by LDH release measurement. Data are expressed as means ± SD, n = 3 separated experiments. Differences between the two groups were determined using Student’s t test (P < 0.01; P < 0.001; P < 0.001 vs. control). NNMT, nicotinamide N-methyltransferase.

    Techniques Used: Inhibition, Transfection, Control

    Figure 7. Protein kinase A (PKA) inhibition compro- mises the protective effect of NNMT inhibition against palmitate-induced cell death. A and B: AML12 cells were treated with either JBSNF-000088 (25 mM) or II399 (25 mM) for 6 h. Total proteins were isolated and PKA substrates detected by Western blotting. The signal of PKS substrates was measured by densitometry and then divided by the signal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 3 separate experiments. Student’s t test was used for statistical evaluation (P < 0.05; P < 0.01 vs. untreated cells). C: AML12 cells were pretreated with either JBSNF-000088 (25 mM) or II399 (25 mM) at the pres- ence/absence of PKA inhibitor, either SQ22536 (200 mM) or H89 (10 mM) for 4 h before palmitate exposure for 16 h. Cell death was determined by LDH release. All data are expressed as means ± SD, n = 3 sepa- rated experiments. Differences between the two groups were determined using Student’s t test (P < 0.05; P < 0.01; P < 0.001 vs control). D: sche- matic illustration of the role and mechanism of NNMT upregulation in palmitate-induced hepatocyte lipotox- icity. The mTORC1-ATF4 pathway activation contrib- utes to palmitate-elicited NNMT upregulation and protein kinase A (PKA) activation contributes to NNMT inhibition-conferred protection against hepatolipotox- icity. NNMT, nicotinamide N-methyltransferase.
    Figure Legend Snippet: Figure 7. Protein kinase A (PKA) inhibition compro- mises the protective effect of NNMT inhibition against palmitate-induced cell death. A and B: AML12 cells were treated with either JBSNF-000088 (25 mM) or II399 (25 mM) for 6 h. Total proteins were isolated and PKA substrates detected by Western blotting. The signal of PKS substrates was measured by densitometry and then divided by the signal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 3 separate experiments. Student’s t test was used for statistical evaluation (P < 0.05; P < 0.01 vs. untreated cells). C: AML12 cells were pretreated with either JBSNF-000088 (25 mM) or II399 (25 mM) at the pres- ence/absence of PKA inhibitor, either SQ22536 (200 mM) or H89 (10 mM) for 4 h before palmitate exposure for 16 h. Cell death was determined by LDH release. All data are expressed as means ± SD, n = 3 sepa- rated experiments. Differences between the two groups were determined using Student’s t test (P < 0.05; P < 0.01; P < 0.001 vs control). D: sche- matic illustration of the role and mechanism of NNMT upregulation in palmitate-induced hepatocyte lipotox- icity. The mTORC1-ATF4 pathway activation contrib- utes to palmitate-elicited NNMT upregulation and protein kinase A (PKA) activation contributes to NNMT inhibition-conferred protection against hepatolipotox- icity. NNMT, nicotinamide N-methyltransferase.

    Techniques Used: Inhibition, Isolation, Western Blot, Control, Activation Assay

    Related Articles

    Transfection:

    Article Title: Nicotinamide N-methyltransferase upregulation via the mTORC1-ATF4 pathway activation contributes to palmitate-induced lipotoxicity in hepatocytes.
    Article Snippet: .. Cells were grown at 80% confluence before the exposure of treatments in various experiments. siRNA Transfection Cultured AML12 hepatocytes were transfected with mouse ATF4 siRNA (Santa Cruz, sc-35113). ..

    Cell Culture:

    Article Title: Nicotinamide N-methyltransferase upregulation via the mTORC1-ATF4 pathway activation contributes to palmitate-induced lipotoxicity in hepatocytes.
    Article Snippet: .. Cells were grown at 80% confluence before the exposure of treatments in various experiments. siRNA Transfection Cultured AML12 hepatocytes were transfected with mouse ATF4 siRNA (Santa Cruz, sc-35113). ..



    Similar Products

    90
    Thermo Fisher sirna targeting mouse atf4 (fitc-labelled)
    Sirna Targeting Mouse Atf4 (Fitc Labelled), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+atf4+sirna/anti+atf6/pm33658516-462-3-32
    Average 90 stars, based on 1 article reviews
    sirna targeting mouse atf4 (fitc-labelled) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    94
    OriGene 164 gfpt1 silencing experiment
    164 Gfpt1 Silencing Experiment, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+atf4+sirna/Atf4+Mouse+siRNA+Oligo+Duplex/pm41528029-75-2-15
    Average 94 stars, based on 1 article reviews
    164 gfpt1 silencing experiment - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    OriGene gfpt1 mouse sirna oligo 183 duplex
    Gfpt1 Mouse Sirna Oligo 183 Duplex, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+atf4+sirna/Atf4+Mouse+siRNA+Oligo+Duplex/pm40331866-76-5-18
    Average 94 stars, based on 1 article reviews
    gfpt1 mouse sirna oligo 183 duplex - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    OriGene si scramble
    Si Scramble, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+atf4+sirna/Atf4+Mouse+siRNA+Oligo+Duplex/pm37995805-80-15-17
    Average 94 stars, based on 1 article reviews
    si scramble - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    OriGene atf4 mouse sirna oligo duplex
    Atf4 Mouse Sirna Oligo Duplex, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+atf4+sirna/Atf4+Mouse+siRNA+Oligo+Duplex/pm37995805-80-5-17
    Average 94 stars, based on 1 article reviews
    atf4 mouse sirna oligo duplex - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    OriGene atf4 silencing experiment
    Atf4 Silencing Experiment, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+atf4+sirna/Atf4+Mouse+siRNA+Oligo+Duplex/pm37995805-80-2-17
    Average 94 stars, based on 1 article reviews
    atf4 silencing experiment - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma sirna targeting mouse atf4
    Sirna Targeting Mouse Atf4, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+atf4+sirna/double+stranded+sirna+targeting+mouse+atf4/pm32740777-74-30-43
    Average 90 stars, based on 1 article reviews
    sirna targeting mouse atf4 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology mouse atf4 sirna
    Figure 4. mTORC1 activation is an upstream event in palmitate induced <t>ATF4</t> activation. A: AML12 cells were pretreated with or without Torin1 (0.25 mM) or rapamycin (Rapa at 50 nM) for 2 h before palmitate (0.4 mM) exposure for 16 h. Total protein was extracted. Protein abundance of ATF4 and actin were detected by Western blotting. The signal of ATF4 protein band was measured by densitometry and then divided by the sig- nal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 3 separate experiments. Student’s t test was used for statistical evaluation (P < 0.001 vs. control). B: AML12 were pretreated with Torin1 (0.25 mM) for 2 h before a 16-h palmitate (0.4 mM) exposure. Total RNA was extracted. ATF4 mRNA levels were detected by real time-qPCR. Data are expressed as means ± SD, n = 4 sep- arated experiments. Differences between the two groups were deter- mined using Student’s t test (P < 0.001 vs. control). ATF, activating transcription factor.
    Mouse Atf4 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+atf4+sirna/ATF-4+siRNA/pm34378991-58-22-25
    Average 93 stars, based on 1 article reviews
    mouse atf4 sirna - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Thermo Fisher sirnas targeting mouse atf4 fitc-labelled
    a Left, image of immunostaining showing broad <t>ATF4</t> expression in mouse DRG neurons. Middle, ATF4 expression was decreased in Atf4 +/− mice. Right, absence of ATF4 immunostaining upon treatment with a blocking peptide. Scale bar, 200 μm. b Size frequency distribution of ATF4-positive and total neurons in the mouse DRG. A total of 1489 neurons from n = 4 mice were analysed. c , d Colocalization of ATF4 and cell markers (IB4, CGRP and NF200) in the DRG ( c ) and sciatic nerve ( d ). Scale bar, 200 μm.
    Sirnas Targeting Mouse Atf4 Fitc Labelled, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+atf4+sirna/anti+atf6/pmc07930092-408-0-25
    Average 90 stars, based on 1 article reviews
    sirnas targeting mouse atf4 fitc-labelled - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Figure 4. mTORC1 activation is an upstream event in palmitate induced ATF4 activation. A: AML12 cells were pretreated with or without Torin1 (0.25 mM) or rapamycin (Rapa at 50 nM) for 2 h before palmitate (0.4 mM) exposure for 16 h. Total protein was extracted. Protein abundance of ATF4 and actin were detected by Western blotting. The signal of ATF4 protein band was measured by densitometry and then divided by the sig- nal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 3 separate experiments. Student’s t test was used for statistical evaluation (P < 0.001 vs. control). B: AML12 were pretreated with Torin1 (0.25 mM) for 2 h before a 16-h palmitate (0.4 mM) exposure. Total RNA was extracted. ATF4 mRNA levels were detected by real time-qPCR. Data are expressed as means ± SD, n = 4 sep- arated experiments. Differences between the two groups were deter- mined using Student’s t test (P < 0.001 vs. control). ATF, activating transcription factor.

    Journal: American journal of physiology. Cell physiology

    Article Title: Nicotinamide N-methyltransferase upregulation via the mTORC1-ATF4 pathway activation contributes to palmitate-induced lipotoxicity in hepatocytes.

    doi: 10.1152/ajpcell.00195.2021

    Figure Lengend Snippet: Figure 4. mTORC1 activation is an upstream event in palmitate induced ATF4 activation. A: AML12 cells were pretreated with or without Torin1 (0.25 mM) or rapamycin (Rapa at 50 nM) for 2 h before palmitate (0.4 mM) exposure for 16 h. Total protein was extracted. Protein abundance of ATF4 and actin were detected by Western blotting. The signal of ATF4 protein band was measured by densitometry and then divided by the sig- nal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 3 separate experiments. Student’s t test was used for statistical evaluation (P < 0.001 vs. control). B: AML12 were pretreated with Torin1 (0.25 mM) for 2 h before a 16-h palmitate (0.4 mM) exposure. Total RNA was extracted. ATF4 mRNA levels were detected by real time-qPCR. Data are expressed as means ± SD, n = 4 sep- arated experiments. Differences between the two groups were deter- mined using Student’s t test (P < 0.001 vs. control). ATF, activating transcription factor.

    Article Snippet: Cells were grown at 80% confluence before the exposure of treatments in various experiments. siRNA Transfection Cultured AML12 hepatocytes were transfected with mouse ATF4 siRNA (Santa Cruz, sc-35113).

    Techniques: Activation Assay, Quantitative Proteomics, Western Blot, Control

    Figure 5. mTORC1 activation contributes to palmi- tate-induced ER stress and NNMT upregulation. A and B: AML12 cells were pretreated with Torin1 (0.25 mM) for 2 h before the palmitate (0.4 mM) exposure for 16 h. Total RNA was extracted. The gene expres- sions of Xbp1, Xbp1s, and Xbp1u were quantified by real time-qPCR and Xbp1s/Xbp1u ratio calculated. Data are expressed as means ± SD, n = 4 different experiments. Differences between the two groups were determined using Student’s t test (P < 0.001vs. control). C: AML12 cells were pretreated with Tornin1 for 2 h before tunicamycin (10 μm) treat- ment for 16 h. Protein abundance of p-S6 and actin was detected by Western blotting. The signal of p-S6 protein band was measured by densitometry and then divided by the signal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 5 separate experiments. Student’s t test was used for statistical evaluation (P < 0.01; P < 0.0001 vs. control). D: Ten- week-old male C57BL/6N mice were injected with tunicamycin (2 mg/kg body wt ip) or isovolumic vehi- cle (150 mM dextrose) and 16 h later livers were har- vested. Protein abundance of ATF4, p-S6 and actin was detected by Western blotting. E: AML12 cells were pretreated with Torin1 (0.25 mM) for 2 h before tunicamycin (10 μm) treatment for 16 h. Protein abun- dance of ATF4 was detected by Western blotting. F: AML12 cells were pretreated with Torin1 for 2 h before tunicamycin (10 μm) treatment for 16 h. Total RNA was extracted and NNMT gene expression quantified by real time-qPCR. All data were expressed as means ± SD, n = 4 separated experiments. Differences between the two groups were determined using Student’s t test (P < 0.01; P < 0.001; P < 0.0001 vs. control). NNMT, nicotinamide N-methyl- transferase; XBP1, X-box binding protein 1.

    Journal: American journal of physiology. Cell physiology

    Article Title: Nicotinamide N-methyltransferase upregulation via the mTORC1-ATF4 pathway activation contributes to palmitate-induced lipotoxicity in hepatocytes.

    doi: 10.1152/ajpcell.00195.2021

    Figure Lengend Snippet: Figure 5. mTORC1 activation contributes to palmi- tate-induced ER stress and NNMT upregulation. A and B: AML12 cells were pretreated with Torin1 (0.25 mM) for 2 h before the palmitate (0.4 mM) exposure for 16 h. Total RNA was extracted. The gene expres- sions of Xbp1, Xbp1s, and Xbp1u were quantified by real time-qPCR and Xbp1s/Xbp1u ratio calculated. Data are expressed as means ± SD, n = 4 different experiments. Differences between the two groups were determined using Student’s t test (P < 0.001vs. control). C: AML12 cells were pretreated with Tornin1 for 2 h before tunicamycin (10 μm) treat- ment for 16 h. Protein abundance of p-S6 and actin was detected by Western blotting. The signal of p-S6 protein band was measured by densitometry and then divided by the signal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 5 separate experiments. Student’s t test was used for statistical evaluation (P < 0.01; P < 0.0001 vs. control). D: Ten- week-old male C57BL/6N mice were injected with tunicamycin (2 mg/kg body wt ip) or isovolumic vehi- cle (150 mM dextrose) and 16 h later livers were har- vested. Protein abundance of ATF4, p-S6 and actin was detected by Western blotting. E: AML12 cells were pretreated with Torin1 (0.25 mM) for 2 h before tunicamycin (10 μm) treatment for 16 h. Protein abun- dance of ATF4 was detected by Western blotting. F: AML12 cells were pretreated with Torin1 for 2 h before tunicamycin (10 μm) treatment for 16 h. Total RNA was extracted and NNMT gene expression quantified by real time-qPCR. All data were expressed as means ± SD, n = 4 separated experiments. Differences between the two groups were determined using Student’s t test (P < 0.01; P < 0.001; P < 0.0001 vs. control). NNMT, nicotinamide N-methyl- transferase; XBP1, X-box binding protein 1.

    Article Snippet: Cells were grown at 80% confluence before the exposure of treatments in various experiments. siRNA Transfection Cultured AML12 hepatocytes were transfected with mouse ATF4 siRNA (Santa Cruz, sc-35113).

    Techniques: Activation Assay, Control, Quantitative Proteomics, Western Blot, Injection, Gene Expression, Binding Assay

    Figure 6. NNMT inhibition protects against palmitate-induced cell death. A: AML12 cells were pretreated with either JBSNF-000088 (20 mM) or II399 (20 mM) at the indicated concentrations for 4 h before palmitate (0.4 mM) exposure for 16 h. Cell viability was determined by LDH release mea- surement. Data are expressed as mean ± SD, n = 3 separated experi- ments. Bars with different character differ significantly (P < 0.05). B: AML12 cells were transfected with either scramble siRNA or NNMT siRNA for 24 h and treated with palmitate at 0.4 mM for 16 h. Cell death was determined by LDH release measurement. Data are expressed as means ± SD, n = 3 separated experiments. Differences between the two groups were determined using Student’s t test (P < 0.01; P < 0.001; P < 0.001 vs. control). NNMT, nicotinamide N-methyltransferase.

    Journal: American journal of physiology. Cell physiology

    Article Title: Nicotinamide N-methyltransferase upregulation via the mTORC1-ATF4 pathway activation contributes to palmitate-induced lipotoxicity in hepatocytes.

    doi: 10.1152/ajpcell.00195.2021

    Figure Lengend Snippet: Figure 6. NNMT inhibition protects against palmitate-induced cell death. A: AML12 cells were pretreated with either JBSNF-000088 (20 mM) or II399 (20 mM) at the indicated concentrations for 4 h before palmitate (0.4 mM) exposure for 16 h. Cell viability was determined by LDH release mea- surement. Data are expressed as mean ± SD, n = 3 separated experi- ments. Bars with different character differ significantly (P < 0.05). B: AML12 cells were transfected with either scramble siRNA or NNMT siRNA for 24 h and treated with palmitate at 0.4 mM for 16 h. Cell death was determined by LDH release measurement. Data are expressed as means ± SD, n = 3 separated experiments. Differences between the two groups were determined using Student’s t test (P < 0.01; P < 0.001; P < 0.001 vs. control). NNMT, nicotinamide N-methyltransferase.

    Article Snippet: Cells were grown at 80% confluence before the exposure of treatments in various experiments. siRNA Transfection Cultured AML12 hepatocytes were transfected with mouse ATF4 siRNA (Santa Cruz, sc-35113).

    Techniques: Inhibition, Transfection, Control

    Figure 7. Protein kinase A (PKA) inhibition compro- mises the protective effect of NNMT inhibition against palmitate-induced cell death. A and B: AML12 cells were treated with either JBSNF-000088 (25 mM) or II399 (25 mM) for 6 h. Total proteins were isolated and PKA substrates detected by Western blotting. The signal of PKS substrates was measured by densitometry and then divided by the signal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 3 separate experiments. Student’s t test was used for statistical evaluation (P < 0.05; P < 0.01 vs. untreated cells). C: AML12 cells were pretreated with either JBSNF-000088 (25 mM) or II399 (25 mM) at the pres- ence/absence of PKA inhibitor, either SQ22536 (200 mM) or H89 (10 mM) for 4 h before palmitate exposure for 16 h. Cell death was determined by LDH release. All data are expressed as means ± SD, n = 3 sepa- rated experiments. Differences between the two groups were determined using Student’s t test (P < 0.05; P < 0.01; P < 0.001 vs control). D: sche- matic illustration of the role and mechanism of NNMT upregulation in palmitate-induced hepatocyte lipotox- icity. The mTORC1-ATF4 pathway activation contrib- utes to palmitate-elicited NNMT upregulation and protein kinase A (PKA) activation contributes to NNMT inhibition-conferred protection against hepatolipotox- icity. NNMT, nicotinamide N-methyltransferase.

    Journal: American journal of physiology. Cell physiology

    Article Title: Nicotinamide N-methyltransferase upregulation via the mTORC1-ATF4 pathway activation contributes to palmitate-induced lipotoxicity in hepatocytes.

    doi: 10.1152/ajpcell.00195.2021

    Figure Lengend Snippet: Figure 7. Protein kinase A (PKA) inhibition compro- mises the protective effect of NNMT inhibition against palmitate-induced cell death. A and B: AML12 cells were treated with either JBSNF-000088 (25 mM) or II399 (25 mM) for 6 h. Total proteins were isolated and PKA substrates detected by Western blotting. The signal of PKS substrates was measured by densitometry and then divided by the signal of its corresponding actin abundance in the same sample. Data are expressed as means ± SD, n = 3 separate experiments. Student’s t test was used for statistical evaluation (P < 0.05; P < 0.01 vs. untreated cells). C: AML12 cells were pretreated with either JBSNF-000088 (25 mM) or II399 (25 mM) at the pres- ence/absence of PKA inhibitor, either SQ22536 (200 mM) or H89 (10 mM) for 4 h before palmitate exposure for 16 h. Cell death was determined by LDH release. All data are expressed as means ± SD, n = 3 sepa- rated experiments. Differences between the two groups were determined using Student’s t test (P < 0.05; P < 0.01; P < 0.001 vs control). D: sche- matic illustration of the role and mechanism of NNMT upregulation in palmitate-induced hepatocyte lipotox- icity. The mTORC1-ATF4 pathway activation contrib- utes to palmitate-elicited NNMT upregulation and protein kinase A (PKA) activation contributes to NNMT inhibition-conferred protection against hepatolipotox- icity. NNMT, nicotinamide N-methyltransferase.

    Article Snippet: Cells were grown at 80% confluence before the exposure of treatments in various experiments. siRNA Transfection Cultured AML12 hepatocytes were transfected with mouse ATF4 siRNA (Santa Cruz, sc-35113).

    Techniques: Inhibition, Isolation, Western Blot, Control, Activation Assay

    a Left, image of immunostaining showing broad ATF4 expression in mouse DRG neurons. Middle, ATF4 expression was decreased in Atf4 +/− mice. Right, absence of ATF4 immunostaining upon treatment with a blocking peptide. Scale bar, 200 μm. b Size frequency distribution of ATF4-positive and total neurons in the mouse DRG. A total of 1489 neurons from n = 4 mice were analysed. c , d Colocalization of ATF4 and cell markers (IB4, CGRP and NF200) in the DRG ( c ) and sciatic nerve ( d ). Scale bar, 200 μm.

    Journal: Nature Communications

    Article Title: ATF4 selectively regulates heat nociception and contributes to kinesin-mediated TRPM3 trafficking

    doi: 10.1038/s41467-021-21731-1

    Figure Lengend Snippet: a Left, image of immunostaining showing broad ATF4 expression in mouse DRG neurons. Middle, ATF4 expression was decreased in Atf4 +/− mice. Right, absence of ATF4 immunostaining upon treatment with a blocking peptide. Scale bar, 200 μm. b Size frequency distribution of ATF4-positive and total neurons in the mouse DRG. A total of 1489 neurons from n = 4 mice were analysed. c , d Colocalization of ATF4 and cell markers (IB4, CGRP and NF200) in the DRG ( c ) and sciatic nerve ( d ). Scale bar, 200 μm.

    Article Snippet: siRNAs targeting mouse ATF4 (FITC-labelled, sense: GCUAGGCAGUGAAGUUGAU), KIF17 (sense: GCCACGCAUUAAUGAAGAC), CXCR4 (sense: GCUAACCCUUAUGCAAAGA), CXCR7 (sense: CCAUGCCUAACAAGAACGU) and a nontargeting siRNA (sense: CCTAAGGTTAAGTCGCCCTCG) were purchased from Thermo Fisher Scientific.

    Techniques: Immunostaining, Expressing, Blocking Assay

    a – j The behaviours of ATF4 siRNA- and scrambled siRNA-injected mice were evaluated by the von Frey ( a ), dynamic ( b ), tape ( c ), tail clip ( d ), pinprick ( e ), Hargreaves ( f ), tail-flick ( g ), hot plate ( h ), evaporative cooling ( i ) and rotarod ( j ) tests. n = 12 mice per group in a – g , i . n = 12 mice in scrambled and n = 11 mice in ATF4 siRNA group in h . n = 10 mice per group in j . t 22 = 4.783, P < 0.0001 in f . t 22 = 5.163 , P < 0.0001 in 48 °C; t 22 = 5.661, P < 0.0001 in 50 °C; t 22 = 10.30, P < 0.0001 in 52 °C in g . t 21 = 2.357, P = 0.0282 in 52 °C; t 21 = 2.804, P = 0.0106 in 55 °C in h . k , l ATF4 siRNA abated SNL-induced thermal hyperalgesia ( k ) but not mechanical allodynia ( l ). n = 12 mice per group. F (1,22) = 56.9, P < 0.0001 in day 0, P = 0.0095 in day 4, P = 0.0013 in day 7, P = 0.0009 in day 10, P = 0.0089 in day 14 in k . m , n ATF4 siRNA abated CFA-induced heat hyperalgesia ( m ) but not mechanical allodynia ( n ). n = 8 mice per group. F (1,14) = 121.6, P < 0.0001 in day 0, P = 0.0007 in day 1, P < 0.0001 in day 3, P = 0.0098 in day 5 in m . o , p Spontaneous pain: total duration ( o ) or number ( p ) of nocifensive behaviour (paw licking or flinching within 2 min) in response to intraplantar injection of vehicle, PS (2.5 nmol/paw) or CIM0216 (2.5 nmol/paw) into ATF4 siRNA and scrambled mice. n = 10 mice per group. t 18 = 3.231, P = 0.0046 in PS, t 18 = 3.286, P = 0.0041 in CIM0216 in o . t 18 = 2.429, P = 0.0258 in PS, t 18 = 3.327, P = 0.0038 in CIM0216 in p . q Spontaneous pain: total duration of nocifensive behaviour (within 5 min) in response to intrathecal injection of vehicle, PS (1.25 nmol/paw) or CIM0216 (1.25 nmol/paw) into ATF4 siRNA and scrambled mice. n = 10 mice per group. t 18 = 3.281, P = 0.0042 in PS, t 18 = 3.024, P = 0.0073 in CIM0216. a – j , o – q Two - tailed Independent Student’s t test; k – n Two-way ANOVA followed by Bonferroni’s multiple comparisons test. * P < 0.05, ** P < 0.01, n.s. means not significant. The error bars indicate the SEMs.

    Journal: Nature Communications

    Article Title: ATF4 selectively regulates heat nociception and contributes to kinesin-mediated TRPM3 trafficking

    doi: 10.1038/s41467-021-21731-1

    Figure Lengend Snippet: a – j The behaviours of ATF4 siRNA- and scrambled siRNA-injected mice were evaluated by the von Frey ( a ), dynamic ( b ), tape ( c ), tail clip ( d ), pinprick ( e ), Hargreaves ( f ), tail-flick ( g ), hot plate ( h ), evaporative cooling ( i ) and rotarod ( j ) tests. n = 12 mice per group in a – g , i . n = 12 mice in scrambled and n = 11 mice in ATF4 siRNA group in h . n = 10 mice per group in j . t 22 = 4.783, P < 0.0001 in f . t 22 = 5.163 , P < 0.0001 in 48 °C; t 22 = 5.661, P < 0.0001 in 50 °C; t 22 = 10.30, P < 0.0001 in 52 °C in g . t 21 = 2.357, P = 0.0282 in 52 °C; t 21 = 2.804, P = 0.0106 in 55 °C in h . k , l ATF4 siRNA abated SNL-induced thermal hyperalgesia ( k ) but not mechanical allodynia ( l ). n = 12 mice per group. F (1,22) = 56.9, P < 0.0001 in day 0, P = 0.0095 in day 4, P = 0.0013 in day 7, P = 0.0009 in day 10, P = 0.0089 in day 14 in k . m , n ATF4 siRNA abated CFA-induced heat hyperalgesia ( m ) but not mechanical allodynia ( n ). n = 8 mice per group. F (1,14) = 121.6, P < 0.0001 in day 0, P = 0.0007 in day 1, P < 0.0001 in day 3, P = 0.0098 in day 5 in m . o , p Spontaneous pain: total duration ( o ) or number ( p ) of nocifensive behaviour (paw licking or flinching within 2 min) in response to intraplantar injection of vehicle, PS (2.5 nmol/paw) or CIM0216 (2.5 nmol/paw) into ATF4 siRNA and scrambled mice. n = 10 mice per group. t 18 = 3.231, P = 0.0046 in PS, t 18 = 3.286, P = 0.0041 in CIM0216 in o . t 18 = 2.429, P = 0.0258 in PS, t 18 = 3.327, P = 0.0038 in CIM0216 in p . q Spontaneous pain: total duration of nocifensive behaviour (within 5 min) in response to intrathecal injection of vehicle, PS (1.25 nmol/paw) or CIM0216 (1.25 nmol/paw) into ATF4 siRNA and scrambled mice. n = 10 mice per group. t 18 = 3.281, P = 0.0042 in PS, t 18 = 3.024, P = 0.0073 in CIM0216. a – j , o – q Two - tailed Independent Student’s t test; k – n Two-way ANOVA followed by Bonferroni’s multiple comparisons test. * P < 0.05, ** P < 0.01, n.s. means not significant. The error bars indicate the SEMs.

    Article Snippet: siRNAs targeting mouse ATF4 (FITC-labelled, sense: GCUAGGCAGUGAAGUUGAU), KIF17 (sense: GCCACGCAUUAAUGAAGAC), CXCR4 (sense: GCUAACCCUUAUGCAAAGA), CXCR7 (sense: CCAUGCCUAACAAGAACGU) and a nontargeting siRNA (sense: CCTAAGGTTAAGTCGCCCTCG) were purchased from Thermo Fisher Scientific.

    Techniques: Injection, Tail Flick Test, Two Tailed Test

    a – j The behaviours of WT, Atf4 +/− and rescued mice were evaluated by the von Frey ( a ), dynamic ( b ), tape ( c ), tail clip ( d ), pinprick ( e ), Hargreaves ( f ), tail-flick ( g ), hot plate ( h ), evaporative cooling ( i ) and rotarod ( j ) tests. n = 10 mice in WT, n = 7 mice in Atf4 +/− and n = 6 mice in rescue group. F (2,20) = 12.11, P = 0.0004 in WT vs. Atf4 +/− , P = 0.0050 in Atf4 +/− vs. rescue in f . F (2,20) = 12.59, P = 0.0008 in WT vs. Atf4 +/− , P = 0.0009 in Atf4 +/− vs. rescue in 48 °C; F (2,20) = 20.67, P < 0.0001 in WT vs. Atf4 +/− , P = 0.0002 in Atf4 +/− vs. rescue in 50 °C; F (2,20) = 8.924, P = 0.0024 in WT vs. Atf4 +/− , P = 0.0076 in Atf4 +/− vs. rescue in 52 °C in g . F (2,20) = 7.097, P = 0.0159 in WT vs. Atf4 +/− , P = 0.0066 in Atf4 +/− vs. rescue in 50 °C; F (2,20) = 5.678, P = 0.0135 in WT vs. Atf4 +/− , P = 0.0375 in Atf4 +/− vs. rescue in 52 °C; F (2,20) = 21.31, P < 0.0001 in WT vs. Atf4 +/− , P < 0.0001 in Atf4 +/− vs. rescue in 55 °C in h . k , l Knockout and rescue of ATF4 impaired and rescued SNL-induced heat hyperalgesia ( k ) but not mechanical allodynia ( l ), respectively. n = 10 mice in WT, n = 9 mice in Atf4 +/− and n = 9 mice in rescue group. F (2,25) = 36; P = 0.0038 in WT vs. Atf4 +/− , P = 0.0098 in Atf4 +/− vs. rescue in day 0; P = 0.0002 in WT vs. Atf4 +/− , P < 0.0001 in Atf4 +/− vs. rescue in day 4; P = 0.0145 in WT vs. Atf4 +/− , P = 0.0170 in Atf4 +/− vs. rescue in day 7; P = 0.0105 in WT vs. Atf4 +/− , P = 0.0034 in Atf4 +/− vs. rescue in day 10; P = 0.0174 in WT vs. Atf4 +/− , P = 0.0087 in Atf4 +/− vs. rescue in day 14 in k . F (2,25) = 1.112; P = 0.0171 in WT vs. Atf4 +/− , P = 0.0074 in Atf4 +/− vs. rescue in day 14 in l . m , n Knockout and rescue of ATF4 impaired and rescued CFA-induced heat hyperalgesia ( m ) but not mechanical allodynia ( n ), respectively. n = 10 mice in WT, n = 9 mice in Atf4 +/− and n = 9 mice in rescue group. F (2,25) = 108.5; P = 0.0002 in WT vs. Atf4 +/− , P = 0.0005 in Atf4 +/− vs. rescue in day 0; P = 0.0045 in WT vs. Atf4 +/− , P = 0.0086 in Atf4 +/− vs. rescue in day 1; P = 0.0001 in WT vs. Atf4 +/− , P = 0.0017 in Atf4 +/− vs. rescue in day 3; P = 0.0006 in WT vs. Atf4 +/− , P < 0.0001 in Atf4 +/− vs. rescue in day 5. o , p Spontaneous pain: total duration ( o ) or number ( p ) of nocifensive behaviour (paw licking or flinching within 2 min) in response to intraplantar injection of vehicle, PS (2.5 nmol/paw) or CIM0216 (2.5 nmol/paw) into WT, Atf4 +/− and rescued mice. n = 10 mice per group. F (2,27) = 6.375, P = 0.0368 in WT vs. Atf4 +/− , P = 0.0056 in Atf4 +/− vs. rescue in PS; F (2,27) = 9.174 , P = 0.0027 in WT vs. Atf4 +/− , P = 0.0026 in Atf4 +/− vs. rescue in CIM0216 in o . F (2,27 ) = 5.976, P = 0.0201 in WT vs. Atf4 +/− , P = 0.0123 in Atf4 +/− vs. rescue in PS; F (2,27) = 7.569 , P = 0.0033 in WT vs. Atf4 +/− , P = 0.0138 in Atf4 +/− vs. rescue in CIM0216 in p . q Spontaneous pain: total duration of nocifensive behaviour (in 5 min) in response to intrathecal injection of vehicle, PS (1.25 nmol/paw) or CIM0216 (1.25 nmol/paw) into WT, Atf4 +/− and rescued mice. n = 10 mice per group. F (2,27) = 5.849, P = 0.0194 in WT vs. Atf4 +/− , P = 0.0146 in Atf4 +/− vs. rescue in PS; F (2,27) = 5.986 , P = 0.0127 in WT vs. Atf4 +/− , P = 0.0192 in Atf4 +/− vs. rescue in CIM0216. a – j , o – q , One-way ANOVA followed by Tukey’s multiple comparisons test. k – n Two-way ANOVA followed by Bonferroni’s multiple comparisons test. * P < 0.05, ** P < 0.01, n.s. means not significant. The errors bars indicate the SEMs.

    Journal: Nature Communications

    Article Title: ATF4 selectively regulates heat nociception and contributes to kinesin-mediated TRPM3 trafficking

    doi: 10.1038/s41467-021-21731-1

    Figure Lengend Snippet: a – j The behaviours of WT, Atf4 +/− and rescued mice were evaluated by the von Frey ( a ), dynamic ( b ), tape ( c ), tail clip ( d ), pinprick ( e ), Hargreaves ( f ), tail-flick ( g ), hot plate ( h ), evaporative cooling ( i ) and rotarod ( j ) tests. n = 10 mice in WT, n = 7 mice in Atf4 +/− and n = 6 mice in rescue group. F (2,20) = 12.11, P = 0.0004 in WT vs. Atf4 +/− , P = 0.0050 in Atf4 +/− vs. rescue in f . F (2,20) = 12.59, P = 0.0008 in WT vs. Atf4 +/− , P = 0.0009 in Atf4 +/− vs. rescue in 48 °C; F (2,20) = 20.67, P < 0.0001 in WT vs. Atf4 +/− , P = 0.0002 in Atf4 +/− vs. rescue in 50 °C; F (2,20) = 8.924, P = 0.0024 in WT vs. Atf4 +/− , P = 0.0076 in Atf4 +/− vs. rescue in 52 °C in g . F (2,20) = 7.097, P = 0.0159 in WT vs. Atf4 +/− , P = 0.0066 in Atf4 +/− vs. rescue in 50 °C; F (2,20) = 5.678, P = 0.0135 in WT vs. Atf4 +/− , P = 0.0375 in Atf4 +/− vs. rescue in 52 °C; F (2,20) = 21.31, P < 0.0001 in WT vs. Atf4 +/− , P < 0.0001 in Atf4 +/− vs. rescue in 55 °C in h . k , l Knockout and rescue of ATF4 impaired and rescued SNL-induced heat hyperalgesia ( k ) but not mechanical allodynia ( l ), respectively. n = 10 mice in WT, n = 9 mice in Atf4 +/− and n = 9 mice in rescue group. F (2,25) = 36; P = 0.0038 in WT vs. Atf4 +/− , P = 0.0098 in Atf4 +/− vs. rescue in day 0; P = 0.0002 in WT vs. Atf4 +/− , P < 0.0001 in Atf4 +/− vs. rescue in day 4; P = 0.0145 in WT vs. Atf4 +/− , P = 0.0170 in Atf4 +/− vs. rescue in day 7; P = 0.0105 in WT vs. Atf4 +/− , P = 0.0034 in Atf4 +/− vs. rescue in day 10; P = 0.0174 in WT vs. Atf4 +/− , P = 0.0087 in Atf4 +/− vs. rescue in day 14 in k . F (2,25) = 1.112; P = 0.0171 in WT vs. Atf4 +/− , P = 0.0074 in Atf4 +/− vs. rescue in day 14 in l . m , n Knockout and rescue of ATF4 impaired and rescued CFA-induced heat hyperalgesia ( m ) but not mechanical allodynia ( n ), respectively. n = 10 mice in WT, n = 9 mice in Atf4 +/− and n = 9 mice in rescue group. F (2,25) = 108.5; P = 0.0002 in WT vs. Atf4 +/− , P = 0.0005 in Atf4 +/− vs. rescue in day 0; P = 0.0045 in WT vs. Atf4 +/− , P = 0.0086 in Atf4 +/− vs. rescue in day 1; P = 0.0001 in WT vs. Atf4 +/− , P = 0.0017 in Atf4 +/− vs. rescue in day 3; P = 0.0006 in WT vs. Atf4 +/− , P < 0.0001 in Atf4 +/− vs. rescue in day 5. o , p Spontaneous pain: total duration ( o ) or number ( p ) of nocifensive behaviour (paw licking or flinching within 2 min) in response to intraplantar injection of vehicle, PS (2.5 nmol/paw) or CIM0216 (2.5 nmol/paw) into WT, Atf4 +/− and rescued mice. n = 10 mice per group. F (2,27) = 6.375, P = 0.0368 in WT vs. Atf4 +/− , P = 0.0056 in Atf4 +/− vs. rescue in PS; F (2,27) = 9.174 , P = 0.0027 in WT vs. Atf4 +/− , P = 0.0026 in Atf4 +/− vs. rescue in CIM0216 in o . F (2,27 ) = 5.976, P = 0.0201 in WT vs. Atf4 +/− , P = 0.0123 in Atf4 +/− vs. rescue in PS; F (2,27) = 7.569 , P = 0.0033 in WT vs. Atf4 +/− , P = 0.0138 in Atf4 +/− vs. rescue in CIM0216 in p . q Spontaneous pain: total duration of nocifensive behaviour (in 5 min) in response to intrathecal injection of vehicle, PS (1.25 nmol/paw) or CIM0216 (1.25 nmol/paw) into WT, Atf4 +/− and rescued mice. n = 10 mice per group. F (2,27) = 5.849, P = 0.0194 in WT vs. Atf4 +/− , P = 0.0146 in Atf4 +/− vs. rescue in PS; F (2,27) = 5.986 , P = 0.0127 in WT vs. Atf4 +/− , P = 0.0192 in Atf4 +/− vs. rescue in CIM0216. a – j , o – q , One-way ANOVA followed by Tukey’s multiple comparisons test. k – n Two-way ANOVA followed by Bonferroni’s multiple comparisons test. * P < 0.05, ** P < 0.01, n.s. means not significant. The errors bars indicate the SEMs.

    Article Snippet: siRNAs targeting mouse ATF4 (FITC-labelled, sense: GCUAGGCAGUGAAGUUGAU), KIF17 (sense: GCCACGCAUUAAUGAAGAC), CXCR4 (sense: GCUAACCCUUAUGCAAAGA), CXCR7 (sense: CCAUGCCUAACAAGAACGU) and a nontargeting siRNA (sense: CCTAAGGTTAAGTCGCCCTCG) were purchased from Thermo Fisher Scientific.

    Techniques: Tail Flick Test, Knock-Out, Injection

    a – j The behaviours of ATF4-overexpressing and control mice were evaluated by the von Frey ( a ), dynamic ( b ), tape ( c ), tail clip ( d ), pinprick ( e ), Hargreaves ( f ), tail-flick ( g ), hot plate ( h ), evaporative cooling ( i ) and rotarod ( j ) tests. n = 12 mice per group in a – e , g , h , j . n = 10 mice per group in f , i . t 18 = 6.308, P < 0.0001 in f . t 22 = 6.893 , P < 0.0001 in 48 °C; t 22 = 8.009, P < 0.0001 in 50 °C; t 22 = 6.831, P < 0.0001 in 52 °C in g . t 22 = 2.373, P = 0.0268 in 50 °C; t 22 = 2.245, P = 0.0352 in 52 °C; t 22 = 2.396, P = 0.0255 in 55 °C in h . k , l Spontaneous pain: total duration ( k ) or number ( l ) of nocifensive behaviour (paw licking or f l inching within 2 min) in response to intraplantar injection of vehicle, PS (2.5 nmol/paw) or CIM0216 (2.5 nmol/paw) into control and ATF4-overexpressing mice. n = 10 mice per group. t 18 = 2.411, P = 0.0268 in PS; t 18 = 2.795, P = 0.0120 in CIM0216 in k . t 18 = 2.775, P = 0.0125 in PS; t 18 = 2.334, P = 0.0314 in CIM0216 in l . m Spontaneous pain: total duration of nocifensive behaviour (in 5 min) in response to intrathecal injection of vehicle, PS (1.25 nmol/paw) or CIM0216 (1.25 nmol/paw) into control and ATF4-overexpressing mice. n = 10 mice per group. t 18 = 2.506, P = 0.0220 in PS; t 18 = 2.46, P = 0.0242 in CIM0216. a – m , Two -t ailed Independent Student’s t test, * P < 0.05, ** P < 0.01, n.s. means not significant. The error bars indicate the SEMs.

    Journal: Nature Communications

    Article Title: ATF4 selectively regulates heat nociception and contributes to kinesin-mediated TRPM3 trafficking

    doi: 10.1038/s41467-021-21731-1

    Figure Lengend Snippet: a – j The behaviours of ATF4-overexpressing and control mice were evaluated by the von Frey ( a ), dynamic ( b ), tape ( c ), tail clip ( d ), pinprick ( e ), Hargreaves ( f ), tail-flick ( g ), hot plate ( h ), evaporative cooling ( i ) and rotarod ( j ) tests. n = 12 mice per group in a – e , g , h , j . n = 10 mice per group in f , i . t 18 = 6.308, P < 0.0001 in f . t 22 = 6.893 , P < 0.0001 in 48 °C; t 22 = 8.009, P < 0.0001 in 50 °C; t 22 = 6.831, P < 0.0001 in 52 °C in g . t 22 = 2.373, P = 0.0268 in 50 °C; t 22 = 2.245, P = 0.0352 in 52 °C; t 22 = 2.396, P = 0.0255 in 55 °C in h . k , l Spontaneous pain: total duration ( k ) or number ( l ) of nocifensive behaviour (paw licking or f l inching within 2 min) in response to intraplantar injection of vehicle, PS (2.5 nmol/paw) or CIM0216 (2.5 nmol/paw) into control and ATF4-overexpressing mice. n = 10 mice per group. t 18 = 2.411, P = 0.0268 in PS; t 18 = 2.795, P = 0.0120 in CIM0216 in k . t 18 = 2.775, P = 0.0125 in PS; t 18 = 2.334, P = 0.0314 in CIM0216 in l . m Spontaneous pain: total duration of nocifensive behaviour (in 5 min) in response to intrathecal injection of vehicle, PS (1.25 nmol/paw) or CIM0216 (1.25 nmol/paw) into control and ATF4-overexpressing mice. n = 10 mice per group. t 18 = 2.506, P = 0.0220 in PS; t 18 = 2.46, P = 0.0242 in CIM0216. a – m , Two -t ailed Independent Student’s t test, * P < 0.05, ** P < 0.01, n.s. means not significant. The error bars indicate the SEMs.

    Article Snippet: siRNAs targeting mouse ATF4 (FITC-labelled, sense: GCUAGGCAGUGAAGUUGAU), KIF17 (sense: GCCACGCAUUAAUGAAGAC), CXCR4 (sense: GCUAACCCUUAUGCAAAGA), CXCR7 (sense: CCAUGCCUAACAAGAACGU) and a nontargeting siRNA (sense: CCTAAGGTTAAGTCGCCCTCG) were purchased from Thermo Fisher Scientific.

    Techniques: Control, Tail Flick Test, Injection

    a – c TRPM3 expression in the DRG membrane fraction ( a ), cytoplasmic fraction ( b ) and total lysate ( c ) from WT and Atf4 +/− mice. n = 3 mice per group. t 4 = 10.3, P = 0.0005 in a . t 4 = 6.043, P = 0.0038 in b . d TRPM3 surface levels were measured in cultured DRG neurons prepared from WT and Atf4 +/− mice using a surface biotinylation assay. n = 3 cultures per group. t 4 = 6.28, P = 0.0033. e Co-IP showing the ATF4/TRPM3 interaction in DRGs. DRG lysates were immunoprecipitated with an ATF4 (top) or TRPM3 (bottom) antibody and immunoblotted with a TRPM3 or ATF4 antibody as indicated. This experiment was repeated three times. f The SIM images show that the colocalization between ATF4 and TRPM3 in DRG neurons. Scale bar, 5 μm. g The GST pull-down assay with two purified proteins, TRPM3-GST-Flag and ATF4, showed a direct interaction between ATF4 and TRPM3. This experiment was repeated three times. h Interaction between TRPM3 and ATF4 mutants. The ATF4 mutants was transiently co-expressed with TRPM3, and the cell lysates were immunoprecipitated with a His antibody and then immunoblotted with a His or Flag antibody as indicated. This experiment was repeated three times. i – k TRPM3 expression in the DRG membrane fraction ( i ), cytoplasmic fraction ( j ) and total lysate ( k ) after ATF4 overexpression. n = 6 mice per group. F (2,15) = 14.31, P = 0.0007 in i . F (2,15) = 30.15, P < 0.0001 in j . l , n , p Time course of a whole-cell patch-clamp recording showing the effect of CIM0216 (3 μM) and isosakuranetin (Iso; 10 μM) on the TRPM3 current in DRG neurons from WT ( l ), Atf4 +/− ( n ) and rescued ( p ) mice. The open circle indicates the outward current recorded at + 75 mV, and the closed circle indicates the inward current recorded at −75 mV. m , o , q I–V relationship of the TRPM3 current at the time points indicated in I , n and p . r Histogram of the TRPM3 current density (outward and inward, current before CIM0216 was subtracted) of DRG neurons from WT, Atf4 +/− and ATF4 rescued mice after CIM0216 treatment. n = 6 neurons per group. F (2,15) = 8.735, P = 0.0049 in WT vs. Atf4 +/− , P = 0.0097 in Atf4 +/− vs. rescue in +75 mV; F (2,15) = 9.158, P = 0.0038 in WT vs. Atf4 +/− , P = 0.0089 in Atf4 +/− vs. rescue in −75 mV. a – d Two-tailed Independent Student’s t test. i , j , k , r , One-way ANOVA followed by Tukey’s multiple comparisons test, * P < 0.05, ** P < 0.01, n.s. means not significant. The error bars indicate the SEMs.

    Journal: Nature Communications

    Article Title: ATF4 selectively regulates heat nociception and contributes to kinesin-mediated TRPM3 trafficking

    doi: 10.1038/s41467-021-21731-1

    Figure Lengend Snippet: a – c TRPM3 expression in the DRG membrane fraction ( a ), cytoplasmic fraction ( b ) and total lysate ( c ) from WT and Atf4 +/− mice. n = 3 mice per group. t 4 = 10.3, P = 0.0005 in a . t 4 = 6.043, P = 0.0038 in b . d TRPM3 surface levels were measured in cultured DRG neurons prepared from WT and Atf4 +/− mice using a surface biotinylation assay. n = 3 cultures per group. t 4 = 6.28, P = 0.0033. e Co-IP showing the ATF4/TRPM3 interaction in DRGs. DRG lysates were immunoprecipitated with an ATF4 (top) or TRPM3 (bottom) antibody and immunoblotted with a TRPM3 or ATF4 antibody as indicated. This experiment was repeated three times. f The SIM images show that the colocalization between ATF4 and TRPM3 in DRG neurons. Scale bar, 5 μm. g The GST pull-down assay with two purified proteins, TRPM3-GST-Flag and ATF4, showed a direct interaction between ATF4 and TRPM3. This experiment was repeated three times. h Interaction between TRPM3 and ATF4 mutants. The ATF4 mutants was transiently co-expressed with TRPM3, and the cell lysates were immunoprecipitated with a His antibody and then immunoblotted with a His or Flag antibody as indicated. This experiment was repeated three times. i – k TRPM3 expression in the DRG membrane fraction ( i ), cytoplasmic fraction ( j ) and total lysate ( k ) after ATF4 overexpression. n = 6 mice per group. F (2,15) = 14.31, P = 0.0007 in i . F (2,15) = 30.15, P < 0.0001 in j . l , n , p Time course of a whole-cell patch-clamp recording showing the effect of CIM0216 (3 μM) and isosakuranetin (Iso; 10 μM) on the TRPM3 current in DRG neurons from WT ( l ), Atf4 +/− ( n ) and rescued ( p ) mice. The open circle indicates the outward current recorded at + 75 mV, and the closed circle indicates the inward current recorded at −75 mV. m , o , q I–V relationship of the TRPM3 current at the time points indicated in I , n and p . r Histogram of the TRPM3 current density (outward and inward, current before CIM0216 was subtracted) of DRG neurons from WT, Atf4 +/− and ATF4 rescued mice after CIM0216 treatment. n = 6 neurons per group. F (2,15) = 8.735, P = 0.0049 in WT vs. Atf4 +/− , P = 0.0097 in Atf4 +/− vs. rescue in +75 mV; F (2,15) = 9.158, P = 0.0038 in WT vs. Atf4 +/− , P = 0.0089 in Atf4 +/− vs. rescue in −75 mV. a – d Two-tailed Independent Student’s t test. i , j , k , r , One-way ANOVA followed by Tukey’s multiple comparisons test, * P < 0.05, ** P < 0.01, n.s. means not significant. The error bars indicate the SEMs.

    Article Snippet: siRNAs targeting mouse ATF4 (FITC-labelled, sense: GCUAGGCAGUGAAGUUGAU), KIF17 (sense: GCCACGCAUUAAUGAAGAC), CXCR4 (sense: GCUAACCCUUAUGCAAAGA), CXCR7 (sense: CCAUGCCUAACAAGAACGU) and a nontargeting siRNA (sense: CCTAAGGTTAAGTCGCCCTCG) were purchased from Thermo Fisher Scientific.

    Techniques: Expressing, Membrane, Cell Culture, Surface Biotinylation Assay, Co-Immunoprecipitation Assay, Immunoprecipitation, Pull Down Assay, Purification, Over Expression, Patch Clamp, Two Tailed Test

    a The diagram shows the experimental procedure. The hindpaws of mice were soaked in a 43 °C water bath for 30 s, and the mice were placed at RT for 2, 5, 10, 20 or 40 min. Then, behavioural, co-IP and membrane protein immunoblotting experiments were performed. b , c ATF4/TRPM3 interactions ( b ) and TRPM3 membrane expression ( c ) in mice were evaluated at different time points after heat stimulation. The experiment was repeated four times in b . n = 6 mice per group in c . F (5,18) = 20.17, P = 0.0007 in 2 min, P < 0.0001 in 5 min, P < 0.0001 in 10 min, P = 0.0044 in 20 min in b . F (5,30) = 10.59, P = 0.0277 in 2 min, P = 0.0022 in 5 min, P < 0.0001 in 10 min, P = 0.0027 in 20 min in c . * P < 0.05, ** P < 0.01 versus the RT group. d The diagram shows the experimental procedure. Isolate d DRG neurons were placed in a 43 °C water bath for 30 s and placed at RT for 2, 5, 10, 20 or 40 min. The neurons were then lysed to detect the membrane abundance of TRPM3. e TRPM3 membrane expression in isolated DRG neurons was evaluated at different time points after direct heat stimulation. n = 3. F (5,12) = 12.3, P = 0.0358 in 2 min, P = 0.0100 in 5 min, P < 0.0001 in 10 min, P = 0.0085 in 20 min. * P < 0.05, ** P < 0.01 versus the RT group. f – h Naïve ( f ), ATF4 siRNA-injected ( g ) and Atf4 +/− ( h ) mice were subjected to the Hargreaves test at different time points after heat stimulation. n = 12 mice per group in f , g . n = 6 mice per group in h . F (5,66) = 14.36, P = 0.0004 in 2 min, P < 0.0001 in 5 min, P < 0.0001 in 10 min, P = 0.0057 in 20 min. ** P < 0.01 versus RT group. One-way ANOVA followed by Tukey’s multiple comparisons test. The error bars indicate the SEMs.

    Journal: Nature Communications

    Article Title: ATF4 selectively regulates heat nociception and contributes to kinesin-mediated TRPM3 trafficking

    doi: 10.1038/s41467-021-21731-1

    Figure Lengend Snippet: a The diagram shows the experimental procedure. The hindpaws of mice were soaked in a 43 °C water bath for 30 s, and the mice were placed at RT for 2, 5, 10, 20 or 40 min. Then, behavioural, co-IP and membrane protein immunoblotting experiments were performed. b , c ATF4/TRPM3 interactions ( b ) and TRPM3 membrane expression ( c ) in mice were evaluated at different time points after heat stimulation. The experiment was repeated four times in b . n = 6 mice per group in c . F (5,18) = 20.17, P = 0.0007 in 2 min, P < 0.0001 in 5 min, P < 0.0001 in 10 min, P = 0.0044 in 20 min in b . F (5,30) = 10.59, P = 0.0277 in 2 min, P = 0.0022 in 5 min, P < 0.0001 in 10 min, P = 0.0027 in 20 min in c . * P < 0.05, ** P < 0.01 versus the RT group. d The diagram shows the experimental procedure. Isolate d DRG neurons were placed in a 43 °C water bath for 30 s and placed at RT for 2, 5, 10, 20 or 40 min. The neurons were then lysed to detect the membrane abundance of TRPM3. e TRPM3 membrane expression in isolated DRG neurons was evaluated at different time points after direct heat stimulation. n = 3. F (5,12) = 12.3, P = 0.0358 in 2 min, P = 0.0100 in 5 min, P < 0.0001 in 10 min, P = 0.0085 in 20 min. * P < 0.05, ** P < 0.01 versus the RT group. f – h Naïve ( f ), ATF4 siRNA-injected ( g ) and Atf4 +/− ( h ) mice were subjected to the Hargreaves test at different time points after heat stimulation. n = 12 mice per group in f , g . n = 6 mice per group in h . F (5,66) = 14.36, P = 0.0004 in 2 min, P < 0.0001 in 5 min, P < 0.0001 in 10 min, P = 0.0057 in 20 min. ** P < 0.01 versus RT group. One-way ANOVA followed by Tukey’s multiple comparisons test. The error bars indicate the SEMs.

    Article Snippet: siRNAs targeting mouse ATF4 (FITC-labelled, sense: GCUAGGCAGUGAAGUUGAU), KIF17 (sense: GCCACGCAUUAAUGAAGAC), CXCR4 (sense: GCUAACCCUUAUGCAAAGA), CXCR7 (sense: CCAUGCCUAACAAGAACGU) and a nontargeting siRNA (sense: CCTAAGGTTAAGTCGCCCTCG) were purchased from Thermo Fisher Scientific.

    Techniques: Co-Immunoprecipitation Assay, Membrane, Western Blot, Expressing, Isolation, Injection

    a – f Co-IP showing the ATF4/KIF interaction in the DRG. DRG lysates were immunoprecipitated with an ATF4 antibody and immunoblotted with a KIF17, KIF3A, KIF3B, KIF5A, KIF5B, KIFC2 or ATF4 antibody as indicated. This experiment was repeated three times. g SIM images show that the colocalization between ATF4 and KIF17 in DRG neurons. Scale bar, 5 μm. h The GST pull-down assay with two purified proteins, KIF17-GST-Flag and ATF4, showed a direct interaction between ATF4 and KIF17. This experiment was repeated three times. i Interaction between KIF17 and ATF4 mutants. The ATF4 mutants were transiently co-expressed with KIF17, and the cell lysates were immunoprecipitated with a His antibody and then immunoblotted with a His or Flag antibody as indicated. This experiment was repeated three times. j The interaction level between TRPM3 and KIF17 was examined by co-IP in scrambled and ATF4 siRNA-treated mice DRG lysates. DRG lysates were immunoprecipitated with a TRPM3 antibody and immunoblotted with a KIF17 or TRPM3 antibody as indicated. This experiment was repeated three times. t 4 = 12.88, P = 0.0002. k SIM images showed the colocalization between TRPM3 and KIF17 in DRG neurons from naïve, ATF4 siRNA and ATF4-overexpresing mice. Quantification data showed the colocalization rates of KIF17 with TRPM3 (colocalized yellow spots/total KIF17 positive spots) and those of TRPM3 with KIF17 (colocalized yellow spots/total TRPM3 positive spots) in DRG neurons. n = 3 mice per group. F (2,6) = 27.17, P = 0.0224 in naïve vs. ATF4-siRNA, P = 0.0255 in naïve vs. ATF4-over in KIF17 with TRPM3. F (2,6) = 33.5, P = 0.0069 in naïve vs. ATF4-siRNA, P = 0.0375 in naïve vs. ATF4-over in TRPM3 with KIF17. Scale bar, 10 μm. j Two-tailed Independent Student’s t test. k One-way ANOVA followed by Tukey’s multiple comparisons test, * P < 0.05, ** P < 0.01. The error bars indicate the SEMs.

    Journal: Nature Communications

    Article Title: ATF4 selectively regulates heat nociception and contributes to kinesin-mediated TRPM3 trafficking

    doi: 10.1038/s41467-021-21731-1

    Figure Lengend Snippet: a – f Co-IP showing the ATF4/KIF interaction in the DRG. DRG lysates were immunoprecipitated with an ATF4 antibody and immunoblotted with a KIF17, KIF3A, KIF3B, KIF5A, KIF5B, KIFC2 or ATF4 antibody as indicated. This experiment was repeated three times. g SIM images show that the colocalization between ATF4 and KIF17 in DRG neurons. Scale bar, 5 μm. h The GST pull-down assay with two purified proteins, KIF17-GST-Flag and ATF4, showed a direct interaction between ATF4 and KIF17. This experiment was repeated three times. i Interaction between KIF17 and ATF4 mutants. The ATF4 mutants were transiently co-expressed with KIF17, and the cell lysates were immunoprecipitated with a His antibody and then immunoblotted with a His or Flag antibody as indicated. This experiment was repeated three times. j The interaction level between TRPM3 and KIF17 was examined by co-IP in scrambled and ATF4 siRNA-treated mice DRG lysates. DRG lysates were immunoprecipitated with a TRPM3 antibody and immunoblotted with a KIF17 or TRPM3 antibody as indicated. This experiment was repeated three times. t 4 = 12.88, P = 0.0002. k SIM images showed the colocalization between TRPM3 and KIF17 in DRG neurons from naïve, ATF4 siRNA and ATF4-overexpresing mice. Quantification data showed the colocalization rates of KIF17 with TRPM3 (colocalized yellow spots/total KIF17 positive spots) and those of TRPM3 with KIF17 (colocalized yellow spots/total TRPM3 positive spots) in DRG neurons. n = 3 mice per group. F (2,6) = 27.17, P = 0.0224 in naïve vs. ATF4-siRNA, P = 0.0255 in naïve vs. ATF4-over in KIF17 with TRPM3. F (2,6) = 33.5, P = 0.0069 in naïve vs. ATF4-siRNA, P = 0.0375 in naïve vs. ATF4-over in TRPM3 with KIF17. Scale bar, 10 μm. j Two-tailed Independent Student’s t test. k One-way ANOVA followed by Tukey’s multiple comparisons test, * P < 0.05, ** P < 0.01. The error bars indicate the SEMs.

    Article Snippet: siRNAs targeting mouse ATF4 (FITC-labelled, sense: GCUAGGCAGUGAAGUUGAU), KIF17 (sense: GCCACGCAUUAAUGAAGAC), CXCR4 (sense: GCUAACCCUUAUGCAAAGA), CXCR7 (sense: CCAUGCCUAACAAGAACGU) and a nontargeting siRNA (sense: CCTAAGGTTAAGTCGCCCTCG) were purchased from Thermo Fisher Scientific.

    Techniques: Co-Immunoprecipitation Assay, Immunoprecipitation, Pull Down Assay, Purification, Two Tailed Test

    a Colocalization of the KIF17, ATF4 and TRPM3 proteins in mouse DRG sections. Scale bar, 200 μm. b Colocalization of KIF17 mRNA , ATF4 mRNA and TRPM3 mRNA in mouse DRG sections. Scale bar, 20 μm. c Colocalization of the KIF17, ATF4 and TRPM3 proteins in DRG neurons was detected by SIM. Scale bar, 5 μm. d , e Changes in the membrane expression of TRPM3 in the DRG after KIF17 knockdown ( d ) or KIF17 overexpression ( e ). n = 6 mice per group. F (2,15) = 34.36, P = 0.0002 in d . F (2,15) = 20.48, P = 0.0005 in e . f The behaviours of KIF17 siRNA- and scrambled siRNA-injected mice were evaluated by the Hargreaves test. n = 6 mice per group. t 10 = 3.485, P = 0.0059. g The behaviours of KIF17-overexpressing and control mice were evaluated by the Hargreaves test. n = 6 mice per group. t 10 = 6.776, P < 0.0001. h ATF4 knockdown suppressed the increased expression of TRPM3 in the membrane induced by KIF17 overexpression. n = 6 mice per group. F (2,15) = 16.19, P = 0.0002 in naïve vs. KIF17-over, P = 0.0014 in KIF17-over vs. KIF17-over + ATF4-siRNA. i KIF17 knockdown inhibited the increase in TRPM3 expression on the cell surface induced by ATF4 overexpression. n = 6 mice per group. F (2,15) = 12.76, P = 0.0025 in naïve vs. ATF4-over, P = 0.0010 in ATF4-over vs. ATF4-over + KIF17-siRNA. ** P < 0.01. d , e , h , i One-way ANOVA followed by Tukey’s multiple comparisons test. f , g Two-tailed Independent Student’s t test. The error bars indicate the SEMs.

    Journal: Nature Communications

    Article Title: ATF4 selectively regulates heat nociception and contributes to kinesin-mediated TRPM3 trafficking

    doi: 10.1038/s41467-021-21731-1

    Figure Lengend Snippet: a Colocalization of the KIF17, ATF4 and TRPM3 proteins in mouse DRG sections. Scale bar, 200 μm. b Colocalization of KIF17 mRNA , ATF4 mRNA and TRPM3 mRNA in mouse DRG sections. Scale bar, 20 μm. c Colocalization of the KIF17, ATF4 and TRPM3 proteins in DRG neurons was detected by SIM. Scale bar, 5 μm. d , e Changes in the membrane expression of TRPM3 in the DRG after KIF17 knockdown ( d ) or KIF17 overexpression ( e ). n = 6 mice per group. F (2,15) = 34.36, P = 0.0002 in d . F (2,15) = 20.48, P = 0.0005 in e . f The behaviours of KIF17 siRNA- and scrambled siRNA-injected mice were evaluated by the Hargreaves test. n = 6 mice per group. t 10 = 3.485, P = 0.0059. g The behaviours of KIF17-overexpressing and control mice were evaluated by the Hargreaves test. n = 6 mice per group. t 10 = 6.776, P < 0.0001. h ATF4 knockdown suppressed the increased expression of TRPM3 in the membrane induced by KIF17 overexpression. n = 6 mice per group. F (2,15) = 16.19, P = 0.0002 in naïve vs. KIF17-over, P = 0.0014 in KIF17-over vs. KIF17-over + ATF4-siRNA. i KIF17 knockdown inhibited the increase in TRPM3 expression on the cell surface induced by ATF4 overexpression. n = 6 mice per group. F (2,15) = 12.76, P = 0.0025 in naïve vs. ATF4-over, P = 0.0010 in ATF4-over vs. ATF4-over + KIF17-siRNA. ** P < 0.01. d , e , h , i One-way ANOVA followed by Tukey’s multiple comparisons test. f , g Two-tailed Independent Student’s t test. The error bars indicate the SEMs.

    Article Snippet: siRNAs targeting mouse ATF4 (FITC-labelled, sense: GCUAGGCAGUGAAGUUGAU), KIF17 (sense: GCCACGCAUUAAUGAAGAC), CXCR4 (sense: GCUAACCCUUAUGCAAAGA), CXCR7 (sense: CCAUGCCUAACAAGAACGU) and a nontargeting siRNA (sense: CCTAAGGTTAAGTCGCCCTCG) were purchased from Thermo Fisher Scientific.

    Techniques: Membrane, Expressing, Knockdown, Over Expression, Injection, Control, Two Tailed Test

    a Cultured DRG neurons were treated with CXCL12 (1 μg/mL) for 120, 240 or 360 min, and then ATF4 expression was measured. n = 6. F (3,20) = 4.642, P = 0.0462 in 120 min, P = 0.0154 in 240 min, P = 0.0128 in 360 min. * P < 0.05 versus 0 min. b CXCL12 (1 μg in 10 μL PBS + 0.5% BSA) was intrathecally injected three times every 3 h, and ATF4 expression was measured in the DRG 2 h after the last injection. n = 6 mice per group. t 10 = 5.151 , P = 0.0004. ** P < 0.01. c ATF4 siRNA signifi c antly relieved CXCL12-induced thermal hyperalgesia. n = 12 mice per group. F (2,33) = 15.68, P < 0.0001 in vehicle vs. CXCL12, P = 0.0101 in CXCL12 vs. CXCL12 + ATF4-siRNA. * P < 0.05, ** P < 0.01. d CXCR4 siRNA but not CXCR7 siRNA abolished the increase in ATF4 expression in the DRG induced by CXCL12 in vivo. n = 6 mice per group. F (3,20) = 54.47, P < 0.0001 in CXCL12, CXCL12 + CXCR4-siRNA and CXCL12 + CXCR7-siRNA. ** P < 0.01 versus the vehicle group, ## P < 0.01 versus the CXCL12 group. e Hypothetical model illustrating that ATF4 interacts with TRPM3 and KIF17 to form a complex to regulate the membrane trafficking of TRPM3 in sensory neurons and thus contributes to thermal sensitivity. a , c , d One-way ANOVA followed by Tukey’s multiple comparisons test. b Two-tailed Independent Student’s t test. The error bars indicate the SEMs.

    Journal: Nature Communications

    Article Title: ATF4 selectively regulates heat nociception and contributes to kinesin-mediated TRPM3 trafficking

    doi: 10.1038/s41467-021-21731-1

    Figure Lengend Snippet: a Cultured DRG neurons were treated with CXCL12 (1 μg/mL) for 120, 240 or 360 min, and then ATF4 expression was measured. n = 6. F (3,20) = 4.642, P = 0.0462 in 120 min, P = 0.0154 in 240 min, P = 0.0128 in 360 min. * P < 0.05 versus 0 min. b CXCL12 (1 μg in 10 μL PBS + 0.5% BSA) was intrathecally injected three times every 3 h, and ATF4 expression was measured in the DRG 2 h after the last injection. n = 6 mice per group. t 10 = 5.151 , P = 0.0004. ** P < 0.01. c ATF4 siRNA signifi c antly relieved CXCL12-induced thermal hyperalgesia. n = 12 mice per group. F (2,33) = 15.68, P < 0.0001 in vehicle vs. CXCL12, P = 0.0101 in CXCL12 vs. CXCL12 + ATF4-siRNA. * P < 0.05, ** P < 0.01. d CXCR4 siRNA but not CXCR7 siRNA abolished the increase in ATF4 expression in the DRG induced by CXCL12 in vivo. n = 6 mice per group. F (3,20) = 54.47, P < 0.0001 in CXCL12, CXCL12 + CXCR4-siRNA and CXCL12 + CXCR7-siRNA. ** P < 0.01 versus the vehicle group, ## P < 0.01 versus the CXCL12 group. e Hypothetical model illustrating that ATF4 interacts with TRPM3 and KIF17 to form a complex to regulate the membrane trafficking of TRPM3 in sensory neurons and thus contributes to thermal sensitivity. a , c , d One-way ANOVA followed by Tukey’s multiple comparisons test. b Two-tailed Independent Student’s t test. The error bars indicate the SEMs.

    Article Snippet: siRNAs targeting mouse ATF4 (FITC-labelled, sense: GCUAGGCAGUGAAGUUGAU), KIF17 (sense: GCCACGCAUUAAUGAAGAC), CXCR4 (sense: GCUAACCCUUAUGCAAAGA), CXCR7 (sense: CCAUGCCUAACAAGAACGU) and a nontargeting siRNA (sense: CCTAAGGTTAAGTCGCCCTCG) were purchased from Thermo Fisher Scientific.

    Techniques: Cell Culture, Expressing, Injection, In Vivo, Membrane, Two Tailed Test